Skip to main content

Advertisement

Table 1 Primers used to detect and to sequence arbovirus from mosquito pools in Kenya

From: Mosquito arbovirus survey in selected areas of Kenya: detection of insect-specific virus

Target Primer name Nucleotide sequence (5′ to 3′) Polarity Product (bp) Cycle condition Reference
Universal primers for flavivirus MAMD AACATGATGGGRAARAGRGARAA Forward 252 94°C, 2 min, 1 cycle; 94°C, 1 min, 53°C, 1 min, 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Scaramozzino et al. (2001) [48]
cFD2 GTGTCCCAGCCGGCGGTGTCATCAGC Reverse
Universal primers for flavivirus FLAVI-1 AATGTACGCTGATGACACAGCTGGCTGGGACAC Forward 854–863 94°C, 5 min, 1 cycle; 94°C, 1 min, 58°C, 1 min, 72°C, 90 s, 45 cycles; 72°C, 10 min, 1 cycle Ayers et al.(2006) [49]
FLAVI-2 TCCAGACCTTCAGCATGTCTTCTGTTGTCATCCA Reverse
Universal primers for flavivirus (mainly YF) YF-1 GGTCTCCTCTAACCTCTAG Forward 675 94°C, 2 min, 1 cycle; 94°C, 30 s, 53°C, 30 s, 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Tanaka et al. (1993) [50]
YF-3 GAGTGGATGACCACGGAAGACATGC Reverse
Universal primers for alpha viruses (mainly chikungunya and o’nyong’nyong viruses) nsP1-S TAGAGCAGGAAATTGATCC Forward 354 94°C, 2 min, 1 cycle; 94°C, 30 s, 53°C, 30 s, 72°C, 45 s, 35 cycles; 72°C, 5 min, 1 cycle Hasebe et al. (2002) [51]
nsP1-C CTTTAATCGCCTGGTGGTA Reverse
Universal primers for alpha viruses (mainly chikungunya and o’nyong’nyong viruses) E1-S TACCCATTCATGTGGGG Forward 294 94°C, 2 min, 1 cycle; 94°C, 30 s, 53°C, 30 s, 72°C, 45 s, 35 cycles; 72°C, 5 min, 1 cycle Hasebe et al. (2002) [51]
E1-C GCCTTTGTACACCACGAT Reverse
Rift Valley virus RVF009 CCAAATGACTACCAGTCAGC Forward 400–500 94°C, 2 min, 1 cycle; 94°C, 30 s, 50°C, 30 s, 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Jupp et al. (2000) [52] (modified)
RVF007 GACAAATGAGTCTGGTAGCA Reverse
Mosquito RNA marker Act-2F ATGGTCGGYATGGGNCAGAAGGACTC Forward 683 94°C, 2 min, 1 cycle; 94°C, 30 s, 54°C, 30 s, 72°C, 45 s, 35 cycles; 72°C, 5 min, 1 cycle Staley et al. (2010) [53]
Act-8R GATTCCATACCCAGGAAGGADGG Reverse
Culex quinquefaciatus ACEpip GGAAACAACGACGTATGTACT Forward 610 94°C, 5 min, 1 cycle; 94°C, 30 s, 54°C, 30 s, 72°C, 1 min, 35 cycles; 72°C, 5 min, 1 cycle Kasai et al. (2008) [39]
ACEquin CCTTCTTGAATGGCTGTGGCA Forward 274
B1246s TGGAGCCTCCTCTTCACGG Reverse  
Aedes aegypti 18SFHIN GTAAGCTTCCTTTGTACACACCGCCCGT Forward 550 97°C, 4 min, 1 cycle; 96°C, 30 s, 48°C, 30 s, 72°C, 2 min, 30 cycles; 72°C, 4 min, 1 cycle Higa et al. (2010) [54]
aeg.r1 TAACGGACACCGTTCTAGGCCCT Reverse
Anopheles funestus, Anopheles rivulorum UV TGTGAACTGCAGGACACAT Forward   94°C, 2 min, 1 cycle; 94°C, 30 s, 45°C, 30 s, 72°C, 40 s, 30 cycles; 72°C, 5 min, 1 cycle Koekemoer et al. (2002) [55]
FUN GCATCGATGGGTTAATCATG Reverse 505
RIV CAAGCCGTTCGACCCTGATT Reverse 411
  1. Note: Each 25 μl reaction mixture contained. (Accupower TM PCR PreMix kit with 2 μl template, 15.2 μl sterile water, and 1.4 μl of 100 pmol/μl each of primers)