Skip to main content

Table 1 Primers for the detection of mecA, lukF-lukS, and 16S rDNA for Staphylococcus aureus

From: Molecular and phenotypic characterization of methicillin-resistant Staphylococcus aureus isolates from a tertiary hospital in the Philippines

Primer Nucleotide sequence (5′ to 3′) Product size (bp)
Staph 756F AACTCTGTTATTAGGGAAGAACA 756
Staph 750R CCAACCTTCCTCCGGTTTGTCACC
Luk-PV-1 ATCATTAGGTAAAATGTCTGGACATGATCCA 433
Luk-PV-2 GCATCAAGTGTATTGGATAGCAAAAGC
MecA1 GTAGAAATGACTGAACGTCCGATAA 310
MecA2 CCAATTCCACATTGTTTCGGTCTAA