Skip to main content

Table 1 Primers used in this study

From: RNA purification-free detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP)

Primer Sequence (5' to 3')
FIP TGGGGTCCATTATCAGACATTTTAGTTTTAGAGTATCATGACGTTCG
BIP CGAAATGCACCCCGCATTACCCACTGCGTTCTCCATTC
FLP TGTTCGTTTAGATGAAATC
BLP TGGTGGACCCTCAGATTCAA
F3 GTTGTTCGTTCTATGAAGACT
B3 GACGTTGTTTTGATCGCG
  1. Features: FIP, Forward inner primer; BIP, backward inner primer; FLP, forward loop primer; BLP, backward loop primer; F3, forward primer; B3, backward primer