Skip to main content

Table 1 Sequences of primers for RT-LAMP designed in accordance with the nucleotide sequence of ZIKV MR strain

From: Detection and discrimination of multiple strains of Zika virus by reverse transcription-loop-mediated isothermal amplification

Primer Sequence (5′–3′)
F3 TTATGACTGCCACACCACC
B3 GCTGAGCTGTATGACCCG
FIP (F1c-F2) GGCTCTCTCTGGGACTTCCACTGAACCCGTGATGCGTTTCC
BIP (B1c-B2) TTGGTTCGTTCCAAGCGTGAGATTTCCAGCCTTTGTCAGACA
Loop-F GTCCATGATTGGTGAGTTAGAGTCA
Loop-B AACGGAAATGAAATCGCAGCC