Skip to main content

Table 1 Oligonucleotide sequences used in this study

From: Development of high-resolution melting curve analysis in rapid detection of vanA gene, Enterococcus faecalis, and Enterococcus faecium from clinical isolates

GeneTargetSequence of primers (5′ to 3′)Melting (Tm)Product size (bp)Ref
divIVAE. faecalisF: ACGTGTCTTCCATCAACGCT
R: ACTGCTGTATGTTTGTCTCCGA
79.9123[11]
Alanine racemaseE. faeciumF: ATCCCTCTGGGCACGCAC
R: ACATACACGCCCAATCGTTTC
85.4248[11]
vanAVancomycinF: GCTGTGAGGTCGGTTGTG
R: GCTCGACTTCCTGATGAATACG
82.9101[11]