Skip to main content

Table 4 Target genes, oligonucleotide primers, and PCR conditions used for the detection of virulence factors and antibiotic resistance genes in the S. epidermidis strains isolated from various types of hospital infectious samples

From: Virulence factors and antibiotic resistance properties of the Staphylococcus epidermidis strains isolated from hospital infections in Ahvaz, Iran

Target gene Primer sequence (5′-3′) PCR product (bp) PCR programs PCR volume (50 μL)
vatA F: TGGTCCCGGAACAACATTTAT
R: TCCACCGACAATAGAATAGGG
268 1 cycle:
94 °C, 5 min
30 cycles:
94 °C, 60 s
60 °C, 60 s
72 °C, 90 s
1 cycle:
72 °C, 7 min
5 μL PCR buffer 10X
1.5 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.25 U Taq DNA polymerase (Fermentas)
2.5 μL DNA template
vatB F: GCTGCGAATTCAGTTGTTACA
R: CTGACCAATCCCACCATTTTA
136
vatC F: AAGGCCCCAATCCAGAAGAA
R: TCAACGTTCTTTGTCACAACC
467
mecA F: AAAATCGATGGTAAAGGTTGGC
R: AGTTCTGCAGTACCGGATTTGC
532
tetK F: GTAGCGACAATAGGTAATAGT
R: GTAGTGACAATAAACCTCCTA
360
tetM F: AGTGGAGCGATTACAGAA
R: CATATGTCCTGGCGTGTCTA
158 1 cycle:
94 °C, 5 min
30 cycles:
94 °C, 60 s
60 °C, 60 s
72 °C, 90 s
1 cycle:
72 °C, 7
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
msrA F: GGCACAATAAGAGTGTTTAAAGG
R: C AAGTTATATCATGAATAGATTGTCCTGTT
940
msrB F: TATGATATCCATAATAATTATCCAATC
R: AAGTTATATCATGAATAGATTGTCCTGTT
595
aacA-D F: TAATCCAAGAGCAATAAGGGC
R: GCCACACTATCATAACCACTA
227
ermA F: AAGCGGTAAACCCCTCTGA
R: TTCGCAAATCCCTTCTCAAC
190
ermC F: AATCGTCAATTCCTGCATGT
R: AATCGTCAATTCCTGCATGT
229
linA F: GGTGGCTGGGGGGTAGATGTATTAACTGG
R: GCTTCTTTTGAAATACATGGTATTTTTCGA
323
tsst-1 F: ATGGCAGCATCAGCTTGATA
R: TTTCCAATAACCACCCGTTT
350 1 cycle:
94 °C, 6 min
30 cycles:
94 °C, 2 min
55 °C, 2 min
72 °C, 1 min
1 cycle:
72 °C, 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
etA F: CTAGTGCATTTGTTATTCAA
R: TGCATTGACACCATAGTACT
119
etB F: ACGGCTATATACATTCAATT
R: TCCATCGATAATATACCTAA
200
agrI F: ATGCACATGGTGCACATGC
R: GTCACAAGTACTATAAGCTGCGAT
441 1 cycle:
94 °C, 6 min
26 cycle:
94 °C, 30 s
55 °C, 30 s
72 °C, 1 min
1 cycle:
72 °C, 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
agrII F: ATGCACATGGTGCACATGC
R: TATTACTAATTGAAAAGTGGCCATAGC
575
agrIII F: ATGCACATGGTGCACATGC
R: GTAATGTAATAGCTTGTATAATAATACCCAG
323
coa F: CGAGACCAAGATTCAACAAG
R: AAAGAAAACCACTCACATCA
970 1 cycle:
95 °C, 2 min
30 cycles:
95 °C, 30 s
58 °C, 2 min
72 °C, 4 min
1 cycle:
72 °C, 7 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
clfA F: GGCTTCAGTGCTTGTAGG
R: TTTTCAGGGTCAATATAAGC
980 1 cycle:
94 °C, 4 min
35 cycles:
94 °C, 1 min
57 °C, 1 min
72 °C, 1 min
1 cycle:
72 °C, 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
X-region F: CAAGCACCAAAAGAGGAA
R: CACCAGGTTTAACGACAT
320 1 cycle:
95 °C, 4 min
25 cycles:
95 °C, 1 min
60 °C, 1 min
72 °C, 1 min
1 cycle:
72 °C, 3 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
IgG-binding region F: CACCTGCTGCAAATGCTGCG
R: GGCTTGTTGTTGTCTTCCTC
920 1 cycle:
94 °C, 2 min
30 cycles:
94 °C, 1 min
58 °C, 1 min
72 °C, 1 min
1 cycle:
72 °C, 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template