Skip to main content

Table 2 Primers for the determination of SCCmec type of MRSA isolates

From: Molecular and phenotypic characterization of methicillin-resistant Staphylococcus aureus isolates from a tertiary hospital in the Philippines

Primer Nucleotide sequence (5′ to 3′) Product size (bp) SCCmec type/region
CIF2 F2 TTCGAGTTGCTGATGAAGAAGG 495 I, IA
CIF2 R2 ATTTACCACAATTACTACCAGC
KDP F1 AATCATCTGCCATTGGTGATGC 284 II
KDP R1 CGAATGAAGTGAAAGAAAGTGG
DCS F2 CATCCTATGATAGCTTGGTC 342 I, IA, II, IV, IVA
DCS R2 CTAAATCATAGCCATGACCG
RIF4 F3 GTGATTGTTCGAGATATGTGG 243 III
RIF4 R9 CGCTTTATCTGTATCTATCGC
IS431 P4 CAGGTCTCTTCAGATCTACG 381 IA, II, IVA
PUB110 R1 GAGCCATAAACACCAATAGCC
MECA P4 TCCAGATTACAACTTCACCAGG 162 mecA gene
MECA P7 CCACTTCATATCTTGTAACG